Answer
427.8k+ views
Hint: One of four bases is attached to each sugar — adenine (A), cytosine ( C), guanine (G), or thymine (T). Hydrogen bonds between the bases keep the two strands together, with adenine forming a base pair with thymine and cytosine forming a base pair with guanine.
Complete step by step answer:
ACGT is an acronym for the DNA molecule's four base types: adenine (A), cytosine (C), guanine (G), and thymine (T). Two strands woven around each other consist of a DNA molecule, with each strand kept together by bonds between the bases. Adenine is combined with thymine, and guanine is combined with cytosine.
The base pairing (or nucleotide pairing) laws are:
- A with T: adenine purine (A) is often combined with thymine pyrimidine (T)
- C with G: cytosine pyrimidine (C) is often combined with guanine purine (G)
Pairs with T and C with G, according to complementary base pairing. The complementary strand for the given sequence will be 3' $-$ TACGTACGTACGTACGTACGTACGTACG $-$ 5’. The sequence of the complementary strand in the direction of 5' to 3' is therefore, 5' $-$ GCATGCATGCATGCATGCATGCATGCATGCAT $-$ 3'.
Additional information: In DNA, complementary base pairing is important because it allows the base pairs to be arranged in the most energetically favorable way; in forming the helical structure of DNA, it is necessary. In replication, it is also important as it enables semiconservative replication.
Note: Chargaff determined that the amount of one base, purine, in DNA is often roughly equal to the amount of a specific second base, pyrimidine. In the DNA double helix, the rule forms the basis of base pairs: A always pairs with T and G always pairs with C.
Complete step by step answer:
ACGT is an acronym for the DNA molecule's four base types: adenine (A), cytosine (C), guanine (G), and thymine (T). Two strands woven around each other consist of a DNA molecule, with each strand kept together by bonds between the bases. Adenine is combined with thymine, and guanine is combined with cytosine.
The base pairing (or nucleotide pairing) laws are:
- A with T: adenine purine (A) is often combined with thymine pyrimidine (T)
- C with G: cytosine pyrimidine (C) is often combined with guanine purine (G)
Pairs with T and C with G, according to complementary base pairing. The complementary strand for the given sequence will be 3' $-$ TACGTACGTACGTACGTACGTACGTACG $-$ 5’. The sequence of the complementary strand in the direction of 5' to 3' is therefore, 5' $-$ GCATGCATGCATGCATGCATGCATGCATGCAT $-$ 3'.
Additional information: In DNA, complementary base pairing is important because it allows the base pairs to be arranged in the most energetically favorable way; in forming the helical structure of DNA, it is necessary. In replication, it is also important as it enables semiconservative replication.
Note: Chargaff determined that the amount of one base, purine, in DNA is often roughly equal to the amount of a specific second base, pyrimidine. In the DNA double helix, the rule forms the basis of base pairs: A always pairs with T and G always pairs with C.
Recently Updated Pages
Mark and label the given geoinformation on the outline class 11 social science CBSE
![arrow-right](/cdn/images/seo-templates/arrow-right.png)
When people say No pun intended what does that mea class 8 english CBSE
![arrow-right](/cdn/images/seo-templates/arrow-right.png)
Name the states which share their boundary with Indias class 9 social science CBSE
![arrow-right](/cdn/images/seo-templates/arrow-right.png)
Give an account of the Northern Plains of India class 9 social science CBSE
![arrow-right](/cdn/images/seo-templates/arrow-right.png)
Change the following sentences into negative and interrogative class 10 english CBSE
![arrow-right](/cdn/images/seo-templates/arrow-right.png)
Advantages and disadvantages of science
![arrow-right](/cdn/images/seo-templates/arrow-right.png)
Trending doubts
Bimbisara was the founder of dynasty A Nanda B Haryanka class 6 social science CBSE
![arrow-right](/cdn/images/seo-templates/arrow-right.png)
Which are the Top 10 Largest Countries of the World?
![arrow-right](/cdn/images/seo-templates/arrow-right.png)
Difference between Prokaryotic cell and Eukaryotic class 11 biology CBSE
![arrow-right](/cdn/images/seo-templates/arrow-right.png)
Differentiate between homogeneous and heterogeneous class 12 chemistry CBSE
![arrow-right](/cdn/images/seo-templates/arrow-right.png)
10 examples of evaporation in daily life with explanations
![arrow-right](/cdn/images/seo-templates/arrow-right.png)
Fill the blanks with the suitable prepositions 1 The class 9 english CBSE
![arrow-right](/cdn/images/seo-templates/arrow-right.png)
Give 10 examples for herbs , shrubs , climbers , creepers
![arrow-right](/cdn/images/seo-templates/arrow-right.png)
How do you graph the function fx 4x class 9 maths CBSE
![arrow-right](/cdn/images/seo-templates/arrow-right.png)
Difference Between Plant Cell and Animal Cell
![arrow-right](/cdn/images/seo-templates/arrow-right.png)