
If the sequence of one strand of DNA is written as follows:
5’$-$ ATGCATGCATGCATGCATGCATGCATGC $-$ 3’
Write down the sequence of the complementary strand in 5’$\rightarrow$3’ direction.
Answer
583.2k+ views
Hint: One of four bases is attached to each sugar — adenine (A), cytosine ( C), guanine (G), or thymine (T). Hydrogen bonds between the bases keep the two strands together, with adenine forming a base pair with thymine and cytosine forming a base pair with guanine.
Complete step by step answer:
ACGT is an acronym for the DNA molecule's four base types: adenine (A), cytosine (C), guanine (G), and thymine (T). Two strands woven around each other consist of a DNA molecule, with each strand kept together by bonds between the bases. Adenine is combined with thymine, and guanine is combined with cytosine.
The base pairing (or nucleotide pairing) laws are:
- A with T: adenine purine (A) is often combined with thymine pyrimidine (T)
- C with G: cytosine pyrimidine (C) is often combined with guanine purine (G)
Pairs with T and C with G, according to complementary base pairing. The complementary strand for the given sequence will be 3' $-$ TACGTACGTACGTACGTACGTACGTACG $-$ 5’. The sequence of the complementary strand in the direction of 5' to 3' is therefore, 5' $-$ GCATGCATGCATGCATGCATGCATGCATGCAT $-$ 3'.
Additional information: In DNA, complementary base pairing is important because it allows the base pairs to be arranged in the most energetically favorable way; in forming the helical structure of DNA, it is necessary. In replication, it is also important as it enables semiconservative replication.
Note: Chargaff determined that the amount of one base, purine, in DNA is often roughly equal to the amount of a specific second base, pyrimidine. In the DNA double helix, the rule forms the basis of base pairs: A always pairs with T and G always pairs with C.
Complete step by step answer:
ACGT is an acronym for the DNA molecule's four base types: adenine (A), cytosine (C), guanine (G), and thymine (T). Two strands woven around each other consist of a DNA molecule, with each strand kept together by bonds between the bases. Adenine is combined with thymine, and guanine is combined with cytosine.
The base pairing (or nucleotide pairing) laws are:
- A with T: adenine purine (A) is often combined with thymine pyrimidine (T)
- C with G: cytosine pyrimidine (C) is often combined with guanine purine (G)
Pairs with T and C with G, according to complementary base pairing. The complementary strand for the given sequence will be 3' $-$ TACGTACGTACGTACGTACGTACGTACG $-$ 5’. The sequence of the complementary strand in the direction of 5' to 3' is therefore, 5' $-$ GCATGCATGCATGCATGCATGCATGCATGCAT $-$ 3'.
Additional information: In DNA, complementary base pairing is important because it allows the base pairs to be arranged in the most energetically favorable way; in forming the helical structure of DNA, it is necessary. In replication, it is also important as it enables semiconservative replication.
Note: Chargaff determined that the amount of one base, purine, in DNA is often roughly equal to the amount of a specific second base, pyrimidine. In the DNA double helix, the rule forms the basis of base pairs: A always pairs with T and G always pairs with C.
Recently Updated Pages
Master Class 11 Computer Science: Engaging Questions & Answers for Success

Master Class 11 Business Studies: Engaging Questions & Answers for Success

Master Class 11 Economics: Engaging Questions & Answers for Success

Master Class 11 English: Engaging Questions & Answers for Success

Master Class 11 Maths: Engaging Questions & Answers for Success

Master Class 11 Biology: Engaging Questions & Answers for Success

Trending doubts
One Metric ton is equal to kg A 10000 B 1000 C 100 class 11 physics CBSE

There are 720 permutations of the digits 1 2 3 4 5 class 11 maths CBSE

Discuss the various forms of bacteria class 11 biology CBSE

Draw a diagram of a plant cell and label at least eight class 11 biology CBSE

State the laws of reflection of light

10 examples of friction in our daily life

